<body><script type="text/javascript"> function setAttributeOnload(object, attribute, val) { if(window.addEventListener) { window.addEventListener('load', function(){ object[attribute] = val; }, false); } else { window.attachEvent('onload', function(){ object[attribute] = val; }); } } </script> <div id="navbar-iframe-container"></div> <script type="text/javascript" src="https://apis.google.com/js/platform.js"></script> <script type="text/javascript"> gapi.load("gapi.iframes:gapi.iframes.style.bubble", function() { if (gapi.iframes && gapi.iframes.getContext) { gapi.iframes.getContext().openChild({ url: 'https://www.blogger.com/navbar/7860500504879331434?origin\x3dhttps://yilintiong.blogspot.com', where: document.getElementById("navbar-iframe-container"), id: "navbar-iframe" }); } }); </script>
HELLO!

Hi guys, YilinTiong here. The owner of this page obviously. 17 this year. Do not be scared by my seriousness when you see me at first glance. Actually, a sense of humor is behind a serious face. :p Hahaha! And sorry if you can't take my straightforwardness-personality.

*Haters hate only the things they can't have and the people they can't be. And they're your biggest fans, they keep wasting time just to watch your every wrong move. ;)

♔♔ Find me at :
Email / Facebook / Twitter

FORMSPRING:

INSTAGRAM:





ADVERTISE:
written on Friday, July 3, 2009 @ 5:33 PM ✈

two post for th day(:
school re-open for me is exciting and tired D:
have to wake up early,and heavy bags ):
slowly will use-ed to it again xD
and start-ing to play wif eye-liners ;D
bought heater eye lash curler LOls
.
andd how ''nice'' Austin and me was quarrelling just now(;
ass-.- should not even think of patch-ing .__.''
we two dont match anyway .
.
♥Replied: Austin,Shayne,Jayden,Nat,Molly,
Lynette,QianHui,PeiXuan,Mark,YiLan,-SDT-Sky,
Shirley,LinEn,Shirleen,JiaYi,Eileen, :) Passer,Gene,
Olivia,(o.o),Ahbby Screams,FaFa,Passerby(J)onus,Kelvin's tag! :D
.
Eileen: wrong link , hahaha , too-muchlove.blogspot.com/
will re-link soon (:
MoLLy: FASTER POST MY LADYYYYYYY !
posting lah!
MoLLy: all ur taggers so weird,only when you post than they tag
yalor,TiongYiLin is so poor to have this kind of readers T.T
-markk: hey cous ! !
hellooooooo :D
Austin: me and shayne won't be tagging cuz school also<3>
okeh and i wont be posting too
Austin: laopo i hate your answer ): but thats only because you angry right? sorry.
sorry nor,who call u dun wan give me time-.-
Shayne: besti tag for you you you you you ==II
thank you you you you you :B
Shayne: wowwwwwwwww austin tag so plain :B ke lian ah~!!!!
你去吃大便 :D yay
MoLLy: wtf even the staff there want your number-.-go out with you dam sian T_T
u always give me this kind of attitude when go out-.-
fine i can go out wif other frens not only u (:
-SDT-Sky: Passing By And TAGG
thanksssss SKY (x
Shirley: Selling M)phosis Inspired Transparent Totes. View my blog for more info.
sure ^^
tiongxim,LinEn: yilin don worry,austin going to escape today to find you but he don want tell you,so u wait for him lor XD jy
....
i dont care bout that ass flirter-.-
Austin: tag laopo (:
ty .
YiLan: haha,tat stupid uncle does he say anything anyway Bedok town is not so bad anyway haha,Tagged u already..
xie xie yilan :D
PEIXUANN`: omgzxzzx i look super retarded in th pirate eye thingy, i forgot to take it down! HAHAH!
hahas! cute can ♥ (:
-♥JiaYI-: Tag...And relink me thx:]
tagged and relink-ed ^^
0livia;beiix: yeahh ... damn kua zhang siiol ... take ur picture and impose as you .. =.=''
chey,how i noe wad she trying to do .___.''
Lynette: Awww, too bad she delete the pictures alrd .
lol,awwwwwwwww yeah xD
Shayne: bestie is all over :D the girl take away all your pics already but she still say she like you =.=
wadever cus CASE-CLOSE! :D
(0.0): eh? got a pic stealer wor
eh? i noe lah-.-
SHIRLEEN: i am sorry but you are pretty
o.o,tys
SHIRLEEN: hey eerm yilin i am sorry that i took your photos and make it as mine, sorry but i just want to say that you are pretty to me and i never even think of i will be caught by paaserbys that who knows you
just hope u wont do it again (:
Gene: may i drop by here for a little longer more hehehe xD
u may but drop a tagg too hahas(:
Gene: hi :D
hellooooo :D
AhBby screams: You're pretty, haha . cnt blame tht person to impose you (: tc .
thx for th scolding hahas! takecare too ^^
Austin: tag too,i want answer ok
orh :x
Austin: laopo someone is your big fan wor ==
http://shirleen-love-life.blogspot.com/ she copycat! ==
also not copy laogong why fierce than me lol
PASSERBY(J)onus: you have to blog? have other girl's blog have your pictures too http://shirleen-love-life.blogspot.com/ hope i can help as i think she not really you 0_0
that's not me(:
but she apologised,thanks for telling ^^
if not u,i won't noe hahas
PEIXUANN`: omg i look so retarded in th foto. hahaa anyway i scan in th neoprints alr, go my blog grab ^^
grabbed ^^ thanks ♥
Kelvin !: OMG! you changed so much leh, meet up soon chiobu haha
siao u not first time come my blog can lols
:) passer: love
i dun wan ur love .__.''
:) passer: your number behind is 3035 right?
shuddup T^T
nat: HAHAHA.
((:
nat: , I SEE PEI XUAN!
ya! :D hehes
JAYDEN: spam
ban u than u noe >:D
JAYDEN: spam

JAYDEN: spam
go die lah,spam so much-.-
JAYDEN: spam
and again
JAYDEN: spam
again
JAYDEN: spam
ty for th spam
Austin: you still haven reply me T_T
i noe ><
Austin: laopo, tag w love :B
谢谢 (:
0livia;beiix: taggie babe ... stary chio uh ... ( i nothing to said so i keep saying this sentence .. dun mind arhx )
thanks for th tag than(;
0livia;beiix: when never scold me before .. already scold beat bully .. duo yi ge tio also nvm de
shh! relax! :3
0livia;beiix: tio larh .. wan tio me tio larh .. noe i got no people help de ... tio larh ... euu when never bully me before .. when never beat me before ... ( my head orhx )
o.o interestingggggggggggggggg ;x
0livia;beiix: choy larh .. euu songka i also haven songka larh ..
aiyoooo all songka lah HAHAAHAH ;x
Lynette: TAGTAGTAGTAGTAGTAGTAG! ^^
TYTYTYTYTYTYTYTY! ^^
TONY: eh olivia ah olivia you nothing to do izzit & hor you songka bodoh i like tio who sia now
dont angry :D
Shayne: wow funfair! i love it! :P haiyo come i extra also lo,yilin i love you! =B lolololololololololol this is call proooo XB
白痴 LOls ;x
fafa: tagged(:
tq sweetheart(:
Austin: laopo why never text me after i ask you that question )= i promise i wont flirt anymore can ==
there's impossible for u not to flirt uh-.-
YiLan: as it is you urself thinking about ur own face hahaha but seriously i try it before
sorry yilan ><
YiLan: lol,there is possible haha but it may be difficult to keep thinking about your face it maybe weird.....
i dont understand LOL
0livia;beiix: yilin ... dun fall for the trick orhx ... starting very good call yoox mummy .. after that dun have good impression liao treat euu like shyt ... i am a passer by orhx .. dun forget ...
hahahas okeh (;
0livia;beiix: tony ... euu see which girl euu like euu call mummy ... the whole world the girl also call mummy larh ...
lax lols
-♥JiaYI-: Tag.....(:
xie xie(:
qiannhui: COUSINNNNNNN!:DD cameby to give youu a taggg!(:
thanks cousin ♥


| back to top






© 2012 - Layout editted by Yilin
Do you know? Honesty is the best policy in life?