Hi guys, YilinTiong here. The owner of this page obviously. 17 this year. Do not be scared by my seriousness when you see me at first glance. Actually, a sense of humor is behind a serious face. :p Hahaha!
And sorry if you can't take my straightforwardness-personality.
*Haters hate only the things they can't have and the people they can't be. And they're your biggest fans, they keep wasting time just to watch your every wrong move. ;) ♔♔ Find me at : Email / Facebook / Twitter FORMSPRING:
INSTAGRAM: ADVERTISE:
LoveEien19 / Trendspotte / HatsForThatFace / Eyesation / Shiberty's Sweet / Daiso's charcoal mask Contact me at yilintiong@hotmail.com for any questions regarding adv. etc recent update :
|
written on Friday, July 3, 2009 @ 5:33 PM ✈
  two post for th day(:
school re-open for me is exciting and tired D: have to wake up early,and heavy bags ):
slowly will use-ed to it again xD and start-ing to play wif eye-liners ;D bought heater eye lash curler LOls . andd how ''nice'' Austin and me was quarrelling just now(;
ass-.- should not even think of patch-ing .__.'' we two dont match anyway . . ♥Replied: Austin,Shayne,Jayden,Nat,Molly, Lynette,QianHui,PeiXuan,Mark,YiLan,-SDT-Sky, Shirley,LinEn,Shirleen,JiaYi,Eileen, :) Passer,Gene, Olivia,(o.o),Ahbby Screams,FaFa,Passerby(J)onus,Kelvin's tag! :D . Eileen: wrong link , hahaha , too-muchlove.blogspot.com/ will re-link soon (:
MoLLy: FASTER POST MY LADYYYYYYY ! posting lah!
MoLLy: all ur taggers so weird,only when you post than they tag yalor,TiongYiLin is so poor to have this kind of readers T.T
-markk: hey cous ! ! hellooooooo :D
Austin: me and shayne won't be tagging cuz school also<3> okeh and i wont be posting too Austin: laopo i hate your answer ): but thats only because you angry right? sorry. sorry nor,who call u dun wan give me time-.- Shayne: besti tag for you you you you you ==II thank you you you you you :B Shayne: wowwwwwwwww austin tag so plain :B ke lian ah~!!!! 你去吃大便 :D yay MoLLy: wtf even the staff there want your number-.-go out with you dam sian T_T u always give me this kind of attitude when go out-.- fine i can go out wif other frens not only u (: -SDT-Sky: Passing By And TAGG thanksssss SKY (x
Shirley: Selling M)phosis Inspired Transparent Totes. View my blog for more info. sure ^^
tiongxim,LinEn: yilin don worry,austin going to escape today to find you but he don want tell you,so u wait for him lor XD jy .... i dont care bout that ass flirter-.-
Austin: tag laopo (: ty .
YiLan: haha,tat stupid uncle does he say anything anyway Bedok town is not so bad anyway haha,Tagged u already.. xie xie yilan :D
PEIXUANN`: omgzxzzx i look super retarded in th pirate eye thingy, i forgot to take it down! HAHAH! hahas! cute can ♥ (:
-♥JiaYI-: Tag...And relink me thx:] tagged and relink-ed ^^
0livia;beiix: yeahh ... damn kua zhang siiol ... take ur picture and impose as you .. =.='' chey,how i noe wad she trying to do .___.''
Lynette: Awww, too bad she delete the pictures alrd . lol,awwwwwwwww yeah xD
Shayne: bestie is all over :D the girl take away all your pics already but she still say she like you =.= wadever cus CASE-CLOSE! :D
(0.0): eh? got a pic stealer wor eh? i noe lah-.-
SHIRLEEN: i am sorry but you are pretty o.o,tys SHIRLEEN: hey eerm yilin i am sorry that i took your photos and make it as mine, sorry but i just want to say that you are pretty to me and i never even think of i will be caught by paaserbys that who knows you just hope u wont do it again (:
Gene: may i drop by here for a little longer more hehehe xD u may but drop a tagg too hahas(:
Gene: hi :D hellooooo :D
AhBby screams: You're pretty, haha . cnt blame tht person to impose you (: tc . thx for th scolding hahas! takecare too ^^
Austin: tag too,i want answer ok orh :x
Austin: laopo someone is your big fan wor == http://shirleen-love-life.blogspot.com/ she copycat! == also not copy laogong why fierce than me lol PASSERBY(J)onus: you have to blog? have other girl's blog have your pictures too http://shirleen-love-life.blogspot.com/ hope i can help as i think she not really you 0_0 that's not me(: but she apologised,thanks for telling ^^ if not u,i won't noe hahas
PEIXUANN`: omg i look so retarded in th foto. hahaa anyway i scan in th neoprints alr, go my blog grab ^^ grabbed ^^ thanks ♥
Kelvin !: OMG! you changed so much leh, meet up soon chiobu haha siao u not first time come my blog can lols
:) passer: love i dun wan ur love .__.''
:) passer: your number behind is 3035 right? shuddup T^T nat: HAHAHA. ((:
nat: , I SEE PEI XUAN! ya! :D hehes
JAYDEN: spam ban u than u noe >:D
JAYDEN: spam JAYDEN: spam go die lah,spam so much-.-
JAYDEN: spam and again
JAYDEN: spam again
JAYDEN: spam ty for th spam
Austin: you still haven reply me T_T i noe ><
Austin: laopo, tag w love :B 谢谢 (:
0livia;beiix: taggie babe ... stary chio uh ... ( i nothing to said so i keep saying this sentence .. dun mind arhx ) thanks for th tag than(; 0livia;beiix: when never scold me before .. already scold beat bully .. duo yi ge tio also nvm de shh! relax! :3
0livia;beiix: tio larh .. wan tio me tio larh .. noe i got no people help de ... tio larh ... euu when never bully me before .. when never beat me before ... ( my head orhx ) o.o interestingggggggggggggggg ;x
0livia;beiix: choy larh .. euu songka i also haven songka larh .. aiyoooo all songka lah HAHAAHAH ;x
Lynette: TAGTAGTAGTAGTAGTAGTAG! ^^ TYTYTYTYTYTYTYTY! ^^
TONY: eh olivia ah olivia you nothing to do izzit & hor you songka bodoh i like tio who sia now dont angry :D
Shayne: wow funfair! i love it! :P haiyo come i extra also lo,yilin i love you! =B lolololololololololol this is call proooo XB 白痴 LOls ;x
fafa: tagged(: tq sweetheart(:
Austin: laopo why never text me after i ask you that question )= i promise i wont flirt anymore can == there's impossible for u not to flirt uh-.-
YiLan: as it is you urself thinking about ur own face hahaha but seriously i try it before sorry yilan >< YiLan: lol,there is possible haha but it may be difficult to keep thinking about your face it maybe weird..... i dont understand LOL
0livia;beiix: yilin ... dun fall for the trick orhx ... starting very good call yoox mummy .. after that dun have good impression liao treat euu like shyt ... i am a passer by orhx .. dun forget ... hahahas okeh (;
0livia;beiix: tony ... euu see which girl euu like euu call mummy ... the whole world the girl also call mummy larh ... lax lols
-♥JiaYI-: Tag.....(: xie xie(:
qiannhui: COUSINNNNNNN!:DD cameby to give youu a taggg!(: thanks cousin ♥ | back to top |